PCR Screening and Restriction Digestion

PCR Screening

Screening of clonies

1.Aliquot 5 ul of autoclaved H2O to 500 ul tubes.

2. Pick  each individual colony, suspend in 5 ul H2O

3. Transfer 0.5~1 ul to PCR screening reaction mix

4. Add 500 ul LB/amp to the rest of  E coli suspension, grow at 37 oC or at room temperature

Screening of culture

1.Aliquot  50 or 100 ul of LB/amp to 1.5 ml tubes.

2. Pick  each individual colony, suspend in medium

3.  Culture in an incubator at 37 oC  for 1 hour

4. Transfer 0.5 ul culture to PCR screening reaction mix

pJet1.2

1. Assemble PCR reaction mix
Per reaction

10X Taq buffer 1.5 µL 
10 uM dNTP mix 0.5 µL
pJET1.2 Forward Sequencing Primer, 10 µM 0.5 µL, or pJET1.2-seq-F2 catatccatccggcgtaatac
pJET1.2 Reverse Sequencing Primer, 10 µM 0.5 µL, or pJET1.2-seq-R2 cagcctgaaaatcttgagag
Water, nuclease-free 11 µL
Taq DNA Polymerase 5 u/µL, 0.5 µL 
Total volume 15 µL

2. Aliquot 14 ul to each tube.

3. Add 0.5 ul bacterial suspension from colony or culture

4. PCR
95 oC 3 min
25~ 30 cycles  of
95 oC 30 s
55 oC 30 s
72 oC 1 min per kb

72 oC 3 min

5. Add 5 ul 6X GRGreen Loading Dye
6. Run on 1% agarose gel

pMiniT

as pJet1.2, but use   these two oligos

pMiniT-seq-R TCAGGGTTATTGTCTCATGAGCG

pMiniT-seq-F ACCTGCCAACCAAAGCGAGAAC

Restriction Enzyme Digestion

1. For PCR positive clones, transfer 10 ul culture to 5 ml LB/amp in 15 ml tube

2. Culture at 37 oC o/N in a shaker-incubator.

3. Spin down cells,

4, Add  250 ul P1, suspend cells by votexing for 1~2 min.

5. Add 250 ul P2. Mix gentely, let lysis for 1 min

6. Add 350 ul N3. Mix 

7. Transfer to 1.5 ml tube.

8, Spin 2 X 3 min.

9. Transfer supernatant to a miniprep column (column from China must be pretreated: soaked in 5 N NaOH for 30min, spin to remove NaOH from column)

10. Spin for 3 sec

11. Add 350 ul PB, spin, remove liquid

12. Add 700 ul PE, spin, remove liquid

13. Spin for 1 min at max speed

14. Add 50 ul EB or TE buffer, soak for 3 sec, 

15. Spin for 1 min at max speed

16. Check DNA quality and quantitate DNA concentration using nanodrop

Digestion

Use 5 ul miniprep for  digestion

1. make mix, per reaction

1.5 ul FastDigestion Buffer

0.3 ul enzyme 1

0.3 ul enzyme 2 (if required)

5 ul miniprep

H2O to 15 ul

2. Incubate at 37 oC  for 30 min in an incubator 

3. Add 5 ul 6X GRGreen loading buffer

4. Run on 1% agarose gel

5. Take a picture using blue light transilluminator 

6. Process gel picture and upload to ELN

7. Document all experimental details

Sequencing

Send positive clone to sequencing company