To-do This week
Jump to navigation
Jump to search
Item List
[edit]| Status | Clone ID | Name | Desciption | Note |
| 1 |
3102 |
ABClone3 |
Sequence with hEF1-HTLV-seq-F (2012_5_15) CCCTTGGAGCCTACCTAG or EF1-HTLV-seq-F (9/14/17) CTGCTTGCTCAACTCTACGTC | |
| 1 | 3028 |
pFuse4 |
Sequence with SV40pA-seq-R (2012_5_15 A07) GCAATAGCATCACAAATTTC |
|
| 1 | look for NTC48165 DH5a dcm- competent cells |
|||
| 1 | look for 192 pCMVS-EGFP plasmid |
|||
| design oligos for 994, 995, 988, 3179 | ||||
| 1 | 3092 |
make some more DNA for phage display |
||
Cloning
[edit]| ID | Status | Plasmid Name | Name | DNA Size | Vector | Method | Status |
Date | Enzyme |
Expression | Note |
| 3195 |
pCMVS-LAMP-1-BCMA |
BCMA in LAMP1 vector | for genetic immune of BCMA | ||||||||
| 3194 |
pCMV5-IL2-BCMA-(3c)-Fc-WPRE-OriP |
BCMA-Fc fusion | |||||||||
| 3192 |
pCMV5-PD-1-Avi-6H-BirA |
PD-1 biotin-6XHis | |||||||||
| 3191 |
pT7A3-GST-Avitag |
GST-Avitag fusion protein | Avi | ||||||||
| 998 | pT7A3-6His-NLS-dCas9-NLS-6xHis |
dCas9 | |||||||||
| 1000 |
pT7A3-6His-NLS-FnCpf1-NLS-6xHis |
FnCpf1 |
|||||||||
| 995 |
pCold-GST-CD133-EC3 |
CD133-EC3 |
|||||||||
| 994 |
pCold-GST-CD133-EC2 |
CD133-EC2 |
|||||||||
| 3196 |
pCMV5-CD47-Avi-6H-BirA |
CD47 |
|||||||||
| 889 |
pCMV-PD1-AviTag-c6His |
PD-1 | |||||||||
| 3197 |
pT7A3-GST-BCMA |
GST-BCMA fusion for ELISA screening | |||||||||
| 3199 |
pCMV5-BCMA-Avi-6H-BirA |
||||||||||
| 2503 |
pCold-VVTopo |
||||||||||
| 3206 |
pEF1-HTLV-LAMP-1-BCMA |