VP16
Design of VP16 for gene synthesis
VP16-pET28b, Digestion with Nde1+ Xho1 or Nco1+ Xho1 should yield 1489bp fragment
miniprep from 8 colonies
Digest DNA with Nde1+ Xho1, Fermentas
Digest DNA with Nco+ Xho1, Fermentas
Digest DNA with Nde1+ Xho1, NEB
plasmid from clone 1, 2 and 8
Digest with Nde1+Xho1 (Fermentas)+AseI using FastDigest buffer
Should yield 660bp, 829bp fragments
==
Plasmid 1 (lane 1, 2, 7), 2 (Lane 3, 4, 8), 8 (Lane 5, 6 9), digested with Xho1 (lane 1, 3 5), or Xho1+Xba1 (Lane 2, 4, 6), or undigested (lane 7, 8, 9). Size are not right --Paul.xu 22:14, 25 October 2010 (EST)
Vp16-pET28b colony PCR screening using T7F + Vp16-36
--Paul.xu 11:13, 26 October 2010 (EST)
2nd PCR screening of VP16-pET28b
re-run sample
--Paul.xu 16:54, 26 October 2010 (EST)
Digest VP16-pET28 miniprep DNA with Nde1 + Xho1
--Paul.xu 12:18, 27 October 2010 (EST)
Sequencing result:
clone 24 is good, although the Nde1 site is not good (not digested completely).
align with pET28b
pET28b CCATGGGCAGCAGCCATCATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCCATATGG
Clone #24 CCATGGGCAGCAGCCATCATCATCATCATCACAGCAGCGGCCTGGTGCCGCG AAAAACATATGG
Need to subclone into Nde1+Xho1 digested pET28b & pDB.His.MBP.
note: vp16-pET28b-20-T7-Term_R.ab1 & vp16-pET28b-20-T7-Term_R.seq are acutually clone 28 (not clone 20). Clone 28 is good, but has not been sequenced with T7.
--Paul.xu 12:19, 29 October 2010 (EST)
Digest VP16-pET28b (clone 24) with Nde1+Xho1 (left: FastDigest, Right: NEB). Cut out insert, sub clone into pET28b and pDB.His.MBP.
After sublconing, (Nde1+Xho1 to cut insert, clone into pET28b and pDBHis.MBP), make miniprep and digest with Nde1+Xho1, or Nco1+ Xho1 :
Digest with Nde1+ Xho1 (NEB enzymes).
Lane 1, 2, 3, 4: Vp16-pDB.His.MBP
Lane 5, 6, 7, 8: vP16-pET28b
Left: digest with Nde1+ Xho1 (FastDigest), Right: digest with Nco1+Xho1 (NEB)
Positive clones: 3,4: VP16-pDBHis.MBP; 5,6,7,8: VP16-pET28b
--Paul.xu 18:59, 31 October 2010 (EST)
Lane 1, 2, 3, pDBHisGST-VP16; Lane 4, 5, 6, pDBHis.NusA-VP16
pDB.His.GST-Vp16 & pDB.His.NusA, digest with Nde1 + Xho1
--Paul.xu 17:20, 8 November 2010 (EST)