User contributions for Paul.xu

15:3315:33, 16 October 2017 diff hist +163 N Ligase Buffer Created page with "1X T4 DNA Ligase Buffer Components 10 mM MgCl2 <br/>50 mM Tris-HCl <br/>1 mM ATP <br/>10 mM DTT <br/>pH 7.5@25°C Category:Buffer Recipe" current
15:0015:00, 16 October 2017 diff hist +4,368 Template swiching cDNA library construction No edit summary current

17:0617:06, 10 October 2017 diff hist +2,667 N Past Tasks Created page with "== Sam: Protein Purification == '''Next Week''' 1. Cre recombinase 1708 pT7A3-HTNCre 2. 1697 pCold-GST-(3c)-wt3C or 1613 pET28-cold-GST-3C 3. Screening of Protei..." current

14:1814:18, 8 October 2017 diff hist +79,477 N CD Proteins Created page with "<div> === Human CD cellular antigens === </div><div><div> {| border="1" cellspacing="0" cellpadding="1" |- ! Antigen<br/>name ! Other<br/>names ! MW ! Structure ! Distribution..." current
10:2310:23, 8 October 2017 diff hist 0 N File:Mbs linker.png No edit summary current

19:3219:32, 4 October 2017 diff hist +53,991 Antibody Drugs No edit summary current

23:0623:06, 2 October 2017 diff hist +5,182 N E coli Expression Host Selection Created page with "There are many expression hosts available for E. coli. The efficiency of protein expression results from appropriate selection of expression host. All of these hosts have the..." current
16:2816:28, 2 October 2017 diff hist +2,263 2196-pT7A3E-PBCV-1-Lig No edit summary current

22:5522:55, 27 September 2017 diff hist +315 N 3020 pCEH0-mIgG1-HC Created page with "<pre> 3020-Xba1-Nhe1-F Xba1 Nhe1 atcatc TCTAGA ttagaatc GCT AGC AGCGCTAAAACGACACCCCCATCTGTCTATC A S S A K T T P P S V Y..." current

23:5523:55, 21 September 2017 diff hist +5,494 N Protein Expression 293 P2 Created page with "Protocol<br/>NOTE: The protocol is suitable for any scale of expression, therefore volumes and quantities of reagents should be scaled proportionally. A suitable mammalian exp..." current
23:5223:52, 21 September 2017 diff hist +32,094 N Protein Expression 293 Created page with "=== Summary === In the post-human genomics era, the availability of recombinant proteins in native conformations is crucial to structural, functional and therapeutic research..." current

22:1022:10, 19 September 2017 diff hist +329 N Protein Expression Fusion Partners Created page with "Translation initiation factor IF-2 [http://www.uniprot.org/uniprot/P0A705 http://www.uniprot.org/uniprot/P0A705] domain 1 MTDVTIKTLA AERQTSVERL VQQFADAGIR KSADDSVSAQ EKQTLID..." current
17:1917:19, 19 September 2017 diff hist +1,362 E coli Secrection Expresion No edit summary current

16:0816:08, 15 September 2017 diff hist +112 Antibody Sequence Database No edit summary current
00:0700:07, 15 September 2017 diff hist +2,354 N HA antibody Created page with "Example 1 Production of Clones R 3F10, R 3A12 and R 6D12 HA peptide preparation The following peptides were synthesized: Bio-C-HA (acetyl-YPYDVPDYAGSGSK (ε-biotinoyl)-amide..." current

23:5123:51, 14 September 2017 diff hist +3,243 N Purification of antibody from hybridoma culture supernatant Created page with "<div>Purification of Monoclonal Antibody from Hybridoma Culture Supernatant </div><div><br/></div><div>Step1: Hyridoma cell culture </div><div>•<span style="..." current
11:3911:39, 14 September 2017 diff hist +1,975 N Purification of Fab Fragment Created page with "Purification of the Fab Fragment-The crude papain digest was fractionated by size-exclusion chromatography on an AcA 44 column (LKB, Bromma, Sweden) (100 X 2.5 cm) with 0.1 M..." current

16:2016:20, 1 September 2017 diff hist +1,217 876 pJet1.2-Dr-Muts No edit summary current
16:1716:17, 1 September 2017 diff hist 0 N File:876 digestion 2.JPG No edit summary current
15:0915:09, 1 September 2017 diff hist +1,440 N BioSimilars Created page with "Rational protein structure/function technologies Glyco-engineering Humanized anti-CD20 monoclonal antibody (Gazyva) Fc fusion VEGFR Fc-fusion (Eylea) CTLA..." current

Navigation menu