User contributions for Paul.xu

17:1717:17, 20 October 2011 diff hist +18,681 Biotech links No edit summary current
11:2711:27, 20 October 2011 diff hist +1,783 N GigaPrep-DMAE-Column Created page with "1. Spin down cells from 5 liters of overnight culture. 2. Suspend bacteria in 125 ml of P1 (50 ml Tris/HCl, 10 MM EDTA, pH 8.0, 100 ÎŒg/ml RNase A) 3. Add 125 ml of buffer P2 (..." current

10:0610:06, 11 October 2011 diff hist +11,713 N Virus QC Created page with "'''AAV Vectors''' '''Plasmid Characterization: ''' 1. Determination of concentration & A260/280 ratio 2. Detection of endotoxin 3. Plasmid identi..." current

11:5211:52, 6 October 2011 diff hist +10,614 Adenovirus Invitrogen No edit summary current
10:5210:52, 6 October 2011 diff hist +6,430 N Adenovirus AdenoX Created page with "== Transfecting HEK 293 Cells with Pac I-Digested Adeno-Xâ¢ DNA == 1. Plate HEK 293 cells at a density of 1â2 x 106 cells per 60-mm culture plate (approximately 100 cells/mm2..." current
10:4210:42, 6 October 2011 diff hist +2,242 Phenol Extraction of DNA No edit summary current
10:2710:27, 6 October 2011 diff hist +9,700 Adenovirus AdEasy No edit summary current

18:4518:45, 5 October 2011 diff hist +4,590 N Adenovirus Titering by Anti-Ad Hexon Staining Created page with "== Protocol 1 == 1. Prepare serial dilutions (typically 1/10) of the stock in 96-well dishes using DMEM + 5% FBS. Final amount for each dilution in each well should be 100 mL. R..." current
18:3818:38, 5 October 2011 diff hist +2,050 Adenovirus Purification by Ultracentrifugation No edit summary current
16:5916:59, 5 October 2011 diff hist +2,308 Plasmid MaxiPrep by Ca Q Sepharose FF No edit summary current
15:1515:15, 5 October 2011 diff hist +1,184 N Qiagen MaxiPrep Created page with "== Anion-Exchange Chromatography using Qiagen MaxiPrep Column == 1. Resuspend E. coli cells in XX mL Buffer P1. 2. Add xx mL Buffer P2, mix the solution, and incubate a..." current

10:5010:50, 1 October 2011 diff hist +531 N Cumate Operon Created page with "<pre>P1 (cym): ATTGACTCTAGGAGTTTTTCAGCCGGATGATCGCGACAAGAA AGAAACAAACCAACCTGTCTGTATTA TCTCCACAG pAdenoS: TCGA ATAATCAAACAGACCAGATTGTCTGTTTG TTTCGACAAGCT..." current

13:4013:40, 28 September 2011 diff hist +4,599 N Lentiviral concentration by anion-exchange chromatography Created page with "= Protocol 1 = Lentiviral concentration by anion-exchange chromatography and ultracentrifugation 1. Set up two Acrodisk units with Mustang Q membranes. Assemble the two Acr..." current
13:3813:38, 28 September 2011 diff hist +9,466 N Lentivirus Concentration by Ultracentrifugation Created page with "= Protocol 1 = Concentrate Lentivirus by ultracentrifugation. Ultracentrifuge: Beckman LE 80K Rotor: SW28 Tubes: #326823 autoclaved (polyallomer) 1. Pool all viral me..." current

16:2616:26, 20 September 2011 diff hist +643 Transfection with MiniPrep DNA No edit summary current
12:1412:14, 20 September 2011 diff hist +641 N MiniPrep Column Regeneration Created page with "1. Save the collection tubes and columns after elution of DNA 2. Fill the column with 700 ÎŒl of 1 M HCl 3. Cap and store in an airtight container for at least 24 hours (..." current

12:2712:27, 18 September 2011 diff hist +416 N Adenovirus Amplification 293F Created page with "1. Grow 293F cells in 293 SFM II (with 4 mM l-glutamine) medium in suspension in a T-flask at 37 Â°C, 5% CO2. 2. Infect 3X10^5 cells in 293 SFM II medium with serotype 5 adenov..." current
12:2012:20, 18 September 2011 diff hist +4,846 M9 No edit summary current

18:1018:10, 7 September 2011 diff hist +6,844 Prepare-Cel1-from-Celery No edit summary current
16:1516:15, 7 September 2011 diff hist +5,064 N Ammonium-Sulfate-Saturation-Table Created page with "'''Amounts of solid ammonium sulfate required to change the % saturation of 100 mL of solution''' The table below is used to determine how much ammonium sulfate (in gram..." current

22:0922:09, 31 August 2011 diff hist +41 N 300 PLentiGP-PKA-Alpha moved 300 PLentiGP-PKA-Alpha to 300 PLentiGP-Gluc-PKA-Alpha current
22:0922:09, 31 August 2011 diff hist +3,049 m 300 PLentiGP-Gluc-PKA-Alpha moved 300 PLentiGP-PKA-Alpha to 300 PLentiGP-Gluc-PKA-Alpha current
18:3418:34, 31 August 2011 diff hist +977 372-pAd5-CMV-PKM2 No edit summary current
18:3218:32, 31 August 2011 diff hist 0 N File:PKM2 PCR digestion.jpg No edit summary current
14:0214:02, 31 August 2011 diff hist +783 N 364 pET3a-MBP-TaqMuts Created page with "== '''Construction of pET3b-MBP-TaqMuts 364''' == '''Purpose:''' construction of pET3b-MBP-TaqMuts (364). '''Date: '''2011-8-31 to 2011-9- '''Notebook:''' '''Page:''' '..." current

Navigation menu