User contributions for Paul.xu

Results for Paul.xu talk block log uploads logs

A user with 13,447 edits. Account created on 25 October 2010.

Jump to navigation Jump to search

20:4420:44, 29 November 2018 diff hist 0 N File:Plasmid isopropanol ppt.JPG No edit summary current

14:0914:09, 8 November 2018 diff hist +5,275 2290 2294 2360 2361 2379 2382 2385 1995 2038 1708 No edit summary current
12:4312:43, 8 November 2018 diff hist +1,282 2381 2383 2386 expression screening 2375 purification No edit summary current

14:4514:45, 4 November 2018 diff hist +487 Plasmid Miniprep using PEG6000 No edit summary current
14:1714:17, 4 November 2018 diff hist +1,066 Plasmid Precipitation using spermine No edit summary current

17:5317:53, 30 October 2018 diff hist 0 N File:CAME from mixed-fragments.png No edit summary current
17:2817:28, 30 October 2018 diff hist 0 N File:3283 145 3257.JPG No edit summary current
17:2717:27, 30 October 2018 diff hist 0 N File:143 PCR w DMSO.JPG No edit summary current
17:2717:27, 30 October 2018 diff hist 0 N File:145 EcoRV PvuII.JPG No edit summary current
15:1715:17, 30 October 2018 diff hist 0 File:CAME cloning.png Paul.xu uploaded a new version of File:CAME cloning.png current

14:5614:56, 28 October 2018 diff hist 0 N File:TPA assembly.png No edit summary current

18:2418:24, 19 October 2018 diff hist +782 643-pT7A3-Nhe1 No edit summary current
18:2118:21, 19 October 2018 diff hist 0 N File:643 Nhe1 QHP.jpg No edit summary current

17:3017:30, 16 October 2018 diff hist +729 3261 pCMV5-anti-mIgG1Fab-rFc-His-Cys No edit summary current
17:3017:30, 16 October 2018 diff hist +658 3260 pCMV5-anti-mIgG2aFc-rFc-His-Cys No edit summary current
17:2917:29, 16 October 2018 diff hist +2,351 3257 pCMV5-anti-mkappa-rFc-His No edit summary current
17:2617:26, 16 October 2018 diff hist 0 N File:3257 3261 3260 INV110.JPG No edit summary current
17:2617:26, 16 October 2018 diff hist 0 N File:3283 PCR.JPG No edit summary current

14:4714:47, 15 October 2018 diff hist +2,037 3258 pCMV5-anti-mIgGFc-rFc-His No edit summary current
14:4614:46, 15 October 2018 diff hist +718 3262 pCMV5-anti-mIgG1Fc-rFc-His-Cys No edit summary current
14:4314:43, 15 October 2018 diff hist 0 N File:3261 3258 3260 3262 3259.JPG No edit summary current
11:5711:57, 15 October 2018 diff hist 0 File:Transfection qc 10 2018 cell viability.JPG Paul.xu uploaded a new version of File:Transfection qc 10 2018 cell viability.JPG current
11:5111:51, 15 October 2018 diff hist 0 N File:Transfection qc 10 2018 efficiency.JPG No edit summary current

17:1817:18, 12 October 2018 diff hist +2,736 N Phosphocellulose Chromatography Created page with "<span style="color: rgb(84, 84, 84); font-family: Roboto, arial, sans-serif; font-size: small;">Whatman P11 Cation Exchange Resin</span> <span style="color: rgb(84, 84, 84);..." current
11:3711:37, 12 October 2018 diff hist +3,841 Purification of DNA-Binding Protein Using HiTrap Heparin HP No edit summary current
10:5710:57, 12 October 2018 diff hist 0 N File:Transfection comparison 10 10 2018.png No edit summary current
10:5710:57, 12 October 2018 diff hist 0 N File:Transfection reagent QC 10 9 2018.png No edit summary current
10:5610:56, 12 October 2018 diff hist 0 N File:Transfection QC 10 2018 Dry vs Lipofectamine 3000.JPG No edit summary current
10:3810:38, 12 October 2018 diff hist 0 N File:Transfection QC 10 2018.JPG No edit summary current
09:3509:35, 12 October 2018 diff hist +38 N Ribosome Binding Sites Created page with "GGAGGT Category:Protein Expression" current

11:0711:07, 10 October 2018 diff hist 0 File:3274 vector digestion.JPG Paul.xu uploaded a new version of File:3274 vector digestion.JPG current
11:0111:01, 10 October 2018 diff hist 0 File:129 2038 Nde Not.JPG Paul.xu uploaded a new version of File:129 2038 Nde Not.JPG current

11:0511:05, 8 October 2018 diff hist +12,493 N Enzyme Properties Created page with "==== Mesophilic DNA Polymerases ==== {| border="1" cellpadding="5" cellspacing="0" |- | Enzyme | 5´→3´ Exonuclease | 3´→5´ Exonuclease | Nick Translation | Heat Inact..." current
10:3110:31, 8 October 2018 diff hist +1,127 1696 1707 1567 1673 1697 No edit summary current

22:0622:06, 5 October 2018 diff hist 0 N File:Kfu Buffer Screening2.JPG No edit summary current
21:3021:30, 5 October 2018 diff hist 0 N File:Kfu KOD Buffer Screening.JPG No edit summary current

18:3218:32, 3 October 2018 diff hist +50 N Q5 Polymerase Buffer Paul.xu moved page Q5 Polymerase Buffer to Q5 Kfu Phusion Pfu Polymerase Buffer current

19:5919:59, 2 October 2018 diff hist +375 Phusion and Kfu Purification No edit summary current

15:3615:36, 30 September 2018 diff hist +56,289 In vitro Protein Translation No edit summary current
12:0612:06, 30 September 2018 diff hist 0 N File:Maltodextrin system.png No edit summary current
11:4411:44, 30 September 2018 diff hist 0 N File:Maltose system.png No edit summary current

18:3818:38, 24 September 2018 diff hist +66,696 S30 E. coli extract No edit summary current

14:3814:38, 23 September 2018 diff hist +877 Ni Buffer A No edit summary current

18:2118:21, 19 September 2018 diff hist +748 N T7A3 Promoter Created page with "T7A1 promoter, the strongest<br/>TTATCAAAAAGAGTATTGACTTAAAGTCTAACCTATAGGATACTTACAGCCATCGAGAGGGACACGGCGA<br/>full T7A1 promoter<br/>TTGTCTTTATTAATACAACTCACTATAAGGAGAGACAACTTAAA..." current

19:0119:01, 18 September 2018 diff hist +74 N Flp Expression Created page with "File:Flpo 293 expression 9 18 2018.jpg Category:Protein Expression" current
19:0019:00, 18 September 2018 diff hist 0 N File:Flpo 293 expression 9 18 2018.jpg No edit summary current

13:0313:03, 13 September 2018 diff hist +3,158 Signal Peptides No edit summary current

17:1717:17, 12 September 2018 diff hist +1,379 N Lipofectin Created page with "Lipofectin Transfection Reagent (Thermofisher Scientific) with a 1:1 of the cationic lipid N-[1-(2,3-dioleyloxy)propyl]-n,n,n-trimethylammonium chloride (DOTMA) and dioleoyl p..." current

14:4614:46, 8 September 2018 diff hist +81 N 3277 pMiniT-Flpo Created page with "File:3277 digestion.JPG File:3277 mix digestion.JPG Category:Cloning" current
14:4414:44, 8 September 2018 diff hist 0 N File:3277 digestion.JPG No edit summary current

Retrieved from "https://eln.excellgen.com/index.php?title=Special:Contributions/Paul.xu"