User contributions for Paul.xu

29 June 2023

• 05:4205:42, 29 June 2023 diff hist +1,404 Web passwords No edit summary current
• 05:3305:33, 29 June 2023 diff hist +8,765 Vendor accounts No edit summary current

17 May 2023

• 10:3110:31, 17 May 2023 diff hist +394 Passwords Replaced content with "<parsererror style="display: block; white-space: pre; border: 2px solid #c77; padding: 0 1em 0 1em; margin: 1em; background-color: #fdd; color: black"> === This page conta..." current

31 October 2022

• 18:0818:08, 31 October 2022 diff hist +340 Sodium Borate No edit summary current

8 October 2022

• 12:4512:45, 8 October 2022 diff hist +9,037 T7 High Yield In vitro Translation No edit summary current

4 October 2022

• 10:2510:25, 4 October 2022 diff hist +886 6X Loading Dye No edit summary current

15 July 2022

• 11:0411:04, 15 July 2022 diff hist +196 Sequence Protocol No edit summary current

14 May 2022

• 20:4920:49, 14 May 2022 diff hist +18 N 2956 Paul.xu moved page 2956 to 2966 current
• 20:4920:49, 14 May 2022 diff hist +7,701 m 2966 Paul.xu moved page 2956 to 2966 current
• 20:4920:49, 14 May 2022 diff hist +18 N 2957 Paul.xu moved page 2957 to 2967 current
• 20:4920:49, 14 May 2022 diff hist +4,471 m 2967 Paul.xu moved page 2957 to 2967 current

4 May 2022

• 20:0620:06, 4 May 2022 diff hist +20,200 MRNA Products No edit summary current

2 April 2022

• 15:2015:20, 2 April 2022 diff hist +8,026 2959 No edit summary current
• 14:5714:57, 2 April 2022 diff hist +12,383 2960 No edit summary current

1 April 2022

• 19:2819:28, 1 April 2022 diff hist 0 N File:2959 2960 digestion.JPG No edit summary current

27 March 2022

• 08:4408:44, 27 March 2022 diff hist +34 N 2892 Created page with "T7-VEE-eCas9-T2A-EGFP not done yet" current
• 07:5307:53, 27 March 2022 diff hist +9,500 N 2931 Created page with "eSpCas9-T2A-EGFP <pre>U6 promoter gagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattggaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggta..." current
• 07:3807:38, 27 March 2022 diff hist +29,927 2938 No edit summary current

26 March 2022

• 17:4317:43, 26 March 2022 diff hist +14,362 N 2947 Created page with "2947 T7ag-VEE-eCas9 subclone from 2939 to VEE vector Nde1-Not1, buffer3.1 <pre> TAATACGACTCACTATAGATGGGCGGCGCATGAGAGAAGCCCAGACCAATTACCTACCCAAAATGGAGAAAGTTCACGTTGACATCGAGGAAG..." current
• 15:2715:27, 26 March 2022 diff hist +21,660 2939 No edit summary current
• 09:5709:57, 26 March 2022 diff hist +18,501 N 2889 Created page with "T7-VEE-FLuc <pre>2889-F: TCATATGTAAGGCGCGCCACCATGGAAGACGCCAAAAACA 2889-R: ttGCGGCCGCGGCCGGCTTACAATTTGGACTTTCCG (CGGAAAGTCCAAATTGTAAGCCGGCCGCGGCCGCaa) clone into pMiniT, then s..." current
• 08:5508:55, 26 March 2022 diff hist +22,569 2885 No edit summary current
• 08:2808:28, 26 March 2022 diff hist +18,902 2794 No edit summary current

23 March 2022

• 09:0309:03, 23 March 2022 diff hist +1,804 Cre FLP mRNA No edit summary current

13 March 2022

• 14:3914:39, 13 March 2022 diff hist 0 N File:Gel purification.JPG No edit summary current
• 14:2014:20, 13 March 2022 diff hist 0 N File:Fluc PCR2.JPG No edit summary current
• 14:1914:19, 13 March 2022 diff hist 0 N File:Fluc PCR.JPG No edit summary current

6 March 2022

• 19:1619:16, 6 March 2022 diff hist +347 2952 No edit summary current
• 18:5818:58, 6 March 2022 diff hist 0 N File:2952 2953 cloning.JPG No edit summary current
• 18:5618:56, 6 March 2022 diff hist 0 N File:2952 PCR Screening.JPG No edit summary current
• 18:5618:56, 6 March 2022 diff hist 0 N File:2952 2953 digestion.JPG No edit summary current
• 18:5618:56, 6 March 2022 diff hist 0 N File:2952 2953 colonies PCR.JPG No edit summary current
• 18:3318:33, 6 March 2022 diff hist 0 N File:2952 digestion1.JPG No edit summary current

21 February 2022

• 16:5416:54, 21 February 2022 diff hist +197 2953 No edit summary current
• 16:5116:51, 21 February 2022 diff hist 0 N File:2953 cloning.JPG No edit summary current
• 12:2012:20, 21 February 2022 diff hist +47,956 Capped mRNA No edit summary current

20 February 2022

• 18:4618:46, 20 February 2022 diff hist +40 N 2942 Created page with "need to check to see if there is a clone" current
• 18:4518:45, 20 February 2022 diff hist +41 N 2492 Created page with "to be cloned or check for completed clone" current
• 15:4915:49, 20 February 2022 diff hist +4,843 N 2955 Created page with " <br/>T7AG<br/>TAATACGACTCACTATAAGG<br/>5'UTR<br/>tcttctggtccccacagactcagagagaacc Nde1 (cloning site 1)<br/>CATATG<br/>TAAGGCGC<br/>5'UTR<br/>GGGAAATAAGAGAGAAAAGAAGAGTAA..." current

15 February 2022

• 20:2620:26, 15 February 2022 diff hist +116,076 His-Tat-NLS-Cre-Purification No edit summary current
• 19:3819:38, 15 February 2022 diff hist +20 N Cre Production Paul.xu moved page Cre Production to Cre QC current
• 19:3819:38, 15 February 2022 diff hist +53 m Cre QC Paul.xu moved page Cre Production to Cre QC current

13 February 2022

• 12:1412:14, 13 February 2022 diff hist +79,933 Cleancap mRNA Invitro Transcription No edit summary
• 11:4411:44, 13 February 2022 diff hist +5,435 MRNA by In vitro Transcription No edit summary current

10 February 2022

• 12:1812:18, 10 February 2022 diff hist +216 2951 No edit summary current

23 January 2022

• 12:3212:32, 23 January 2022 diff hist +30,150 Plasmid buffers No edit summary current

21 January 2022

• 22:5622:56, 21 January 2022 diff hist 0 N File:2951 bglII.JPG No edit summary current

16 January 2022

• 21:3021:30, 16 January 2022 diff hist 0 N File:2951 EagI digestion.JPG No edit summary current
• 17:4317:43, 16 January 2022 diff hist +635 N MRNA Production Created page with "{| border="1" cellspacing="1" cellpadding="1" style="width:500px;" |- | Name | ID | Location | Size | Link | Digestion |- | T7-VEE-TagGFP2-E3L<br/> | 2794<br/> | 35A6 | 11047..." current

2 December 2021

• 19:2419:24, 2 December 2021 diff hist +15,764 Proteins in Freezer No edit summary current