User contributions for Paul.xu

20 May 2017

• 16:2816:28, 20 May 2017 diff hist +580 N Purification Tags Created page with "ceramic fluorapatite-binding peptides: KPRSVSG PA tag ( from human podoplanin PLAG domain)<br/>GVAMPGAEDDVV<br/>MPA tag<br/>GDGMVPPGIEDK<br/>Fc-binding hexamer peptides (HWRG..." current

18 May 2017

• 17:3417:34, 18 May 2017 diff hist +2,222 1631 1693 1898 1934 1924 1926 1942 1995 2001 No edit summary current
• 08:5708:57, 18 May 2017 diff hist +82 N MS-R-5-13-2017 Created page with "Finish Weekly report Every Friday before leaving the lab Category:Reports" current

7 May 2017

• 15:4515:45, 7 May 2017 diff hist +53 N 2493 pCMV5-mIgG2a-kLC Created page with "File:2492 2493 digestion.JPG Category:Cloning" current
• 15:4215:42, 7 May 2017 diff hist +55 N 2492 pCMV5-mIgG2a-HC Created page with "File:2492 2493 digestion.JPG Category:Cloning" current
• 15:4115:41, 7 May 2017 diff hist +98 N 2491 pMiniT-mIgG2a-kLC Created page with "File:2490 2491 EcoR1 digestion.JPG File:2490 2491 xho1 digestion.JPG Category:Cloning" current
• 15:4115:41, 7 May 2017 diff hist +102 N 2490 pMiniT-mIgG2a-HC Created page with "File:2490 2491 EcoR1 digestion.JPG File:2490 2491 xho1 digestion.JPG Category:Cloning" current
• 15:3815:38, 7 May 2017 diff hist 0 N File:2490 2491 xho1 digestion.JPG No edit summary current
• 15:3815:38, 7 May 2017 diff hist 0 N File:2490 2491 EcoR1 digestion.JPG No edit summary current
• 15:2915:29, 7 May 2017 diff hist 0 N File:2492 2493 digestion.JPG No edit summary current

3 May 2017

• 17:2417:24, 3 May 2017 diff hist +368 N Remove nuclease Created page with "I used to use streptomycin to eliminate nucleic acids from my proteins extracts. I usually precipitate the crude extract with streptomaycin at 4 C, then I centrifuge at 12,000..." current

26 April 2017

• 14:3914:39, 26 April 2017 diff hist +11,253 Clone antibody from Hybridoma No edit summary current
• 10:5810:58, 26 April 2017 diff hist +279 N Tris-Glycine Buffer Created page with "10X Running buffer<br/>Dissolve 30.0 g of Tris base, 144.0 g of glycine, and 10.0 g of SDS in 1000 ml of H2O. The pH of the buffer should be 8.3 and no pH adjustment is requir..." current

21 April 2017

• 15:1415:14, 21 April 2017 diff hist +450 N Hot start reverse transcriptase Created page with "[https://jast-journal.springeropen.com/articles/10.1186/s40543-015-0063-4 https://jast-journal.springeropen.com/articles/10.1186/s40543-015-0063-4] M-MLV RT Atapmer 5′-CUU..." current

17 April 2017

• 17:4417:44, 17 April 2017 diff hist +1,522 Fast Eletrophoresis Buffer No edit summary current
• 16:4116:41, 17 April 2017 diff hist +63,698 In vitro diagnostics No edit summary current

7 April 2017

• 10:0410:04, 7 April 2017 diff hist +1,939 N Proteases Created page with "{| |- | 6His-3C | 0 | width="95" | 1797 | 1510 | pCold-6His-3C-MBP | 6His tagged wildtype native 3C fused to MBP, MBP at C-terminus | N-6His, C-MBP | width="49" | PCR | wt | 6..." current

5 April 2017

• 13:0113:01, 5 April 2017 diff hist +3,410 N Peptide conjugation to KHL Created page with "Preparation Of Peptide-KLH Conjugates For Immunization Claire Walczak<br/>January 1996 These are basically Tim's procedures and have been used successfully by numerous membe..." current

3 April 2017

• 16:3716:37, 3 April 2017 diff hist +709 Glycine HCl Buffer No edit summary current

16 March 2017

• 11:4511:45, 16 March 2017 diff hist +484 Thermostable Reverse Transcriptase No edit summary current

15 March 2017

• 10:3910:39, 15 March 2017 diff hist +11,136 Phusion Polymerase No edit summary current

14 March 2017

• 14:0614:06, 14 March 2017 diff hist +6,724 T3 DNA Ligase No edit summary current

12 March 2017

• 12:1312:13, 12 March 2017 diff hist +2,085 N Plasmid using Silica Gel Created page with "=== '''Silicon dioxide''' === Suspend 60 g Silica particles (silicon dioxide, SiO2; Sigma Chemical Co., St. Louis, Mo.) in 500 ml ddH2O water in a total volume of 500 ml for..." current

7 March 2017

• 16:5216:52, 7 March 2017 diff hist 0 N File:105-1811 vPol QHP 3 1 2017.jpeg No edit summary current
• 15:5115:51, 7 March 2017 diff hist +12,313 Protein Expression Vibrio natriegens No edit summary current

5 March 2017

• 19:5119:51, 5 March 2017 diff hist +2,326 N Electrotransformation of Vibro Created page with "== Electroporation protocol == <br/>1. For each transformation reaction,<br/>• Thaw one vial of Vmax™ Express Electrocompetent cells on ice for 5 minutes.<br/>• Warm on..." current
• 15:2315:23, 5 March 2017 diff hist +4,658 N ElectroCompetent Cells Created page with "== Preparation of Bacterial Cultures, Tools, and Reagents (DAY 1, Afternoon) == <br/>1. In the late afternoon, inoculate 1-5 ml autoclaved'''LB broth''' in sterile (for examp..." current

4 March 2017

• 18:0818:08, 4 March 2017 diff hist +1,283 1708 2116 2115 2107Taq-muts No edit summary current

28 February 2017

• 17:2117:21, 28 February 2017 diff hist +14,477 Anti-Taq Antibody No edit summary current

22 February 2017

• 18:2618:26, 22 February 2017 diff hist +7,548 Taq for Real Time PCR No edit summary current
• 17:2217:22, 22 February 2017 diff hist +333 N 1811 VPol Purification Created page with "== '''Purification of 1811 vPol''' == '''Purpose:'''  '''Date: '''2017/2/22~ '''Notebook: 008260 ''' '''Page: 008260 ~''' '''Clone ID:1811''' '''Experimen..." current

20 February 2017

• 23:0723:07, 20 February 2017 diff hist +889 Hot Start PCR using Ecoli SSB No edit summary current
• 17:5617:56, 20 February 2017 diff hist +56,252 TREC ASSAY No edit summary current
• 16:2716:27, 20 February 2017 diff hist +1,879 N Hot Start PCR QC Created page with "=== '''TREC''' === '''TREC_HDimer_F''' 5'-CACATCCCTTTCAACCATGCTG -3' LENGTH 22 GC CONTENT 50 % MEL TTEMP 56.6 ºC '''TREC_HDimer_R''' AGGGCCCGTGCCAGCTGCAG LENGTH..." current

19 February 2017

• 21:4421:44, 19 February 2017 diff hist +7,270 Taq-Citraconylation No edit summary current
• 21:4221:42, 19 February 2017 diff hist +9 N Hot Start PCR using T7 gp2.5 Created page with "US8404443" current
• 21:3021:30, 19 February 2017 diff hist +317 N Hot Start PCR using D705Pexo(−)Klenow Created page with "5~50 ng <span style="color: rgb(34, 34, 34); font-family: Arial, sans-serif; font-size: 13.3333px;">D705P exo(−) Klenow Mutant will have good hot start activity </..." current
• 21:0721:07, 19 February 2017 diff hist +1,151 N Hot Start PCR using RecA Created page with "== Purification == Clone into pET vector. Transform Escherichia coli BL21(DE3)/pLysN cells with plasmid Grow cells to OD600  0.5 and induced tith 1 mM  IPTG..." current

17 February 2017

• 19:0319:03, 17 February 2017 diff hist +602 2443 pET28b-Tn5TPnase No edit summary current
• 19:0319:03, 17 February 2017 diff hist +600 2474 pET30-HA-Tn5-6His No edit summary current

23 January 2017

• 19:2619:26, 23 January 2017 diff hist +230 N 6XHis-sso7d-wt-Taq Purification Created page with "== Lysis Buffer == File:Taq Lysis Buffer Salt Extraction.jpg Conclusion: To extract Taq DNA polymerase, lysis buffer should contain 0.5 M NaCl. Also pelle..." current
• 19:1419:14, 23 January 2017 diff hist 0 N File:Taq Lysis Buffer Salt Extraction.jpg No edit summary current

22 January 2017

• 12:1312:13, 22 January 2017 diff hist +5,698 BradFord Assay No edit summary current

20 January 2017

• 19:0519:05, 20 January 2017 diff hist +1,465 N Purification of Taq DNA Polymerase Created page with "== Buffers == '''Lysis Buffer''' {| border="1" cellspacing="1" cellpadding="1" style="width:500px;" |- | 20 mM Tris-HCl, pH 8.0<br/> | <br/> |- | 500 mM NaCl<br/> | <br/> |-..." current

18 January 2017

• 18:2818:28, 18 January 2017 diff hist +2,132 DNA-Cellulose No edit summary current

16 January 2017

• 18:4818:48, 16 January 2017 diff hist +446 Commercial Hot Start Polymerases No edit summary current
• 18:4818:48, 16 January 2017 diff hist 0 N File:Commercial hot start polymerases list.png No edit summary current
• 18:4718:47, 16 January 2017 diff hist 0 N File:Commercial hot start polymerases.png No edit summary current

15 January 2017

• 22:2822:28, 15 January 2017 diff hist +5,082 Synthesis of GO-PEI No edit summary current
• 13:0613:06, 15 January 2017 diff hist +33 N Systhesis of GO-PEI Paul.xu moved page Systhesis of GO-PEI to Synthesis of GO-PEI current